Custom DNA (left)Alpha DNA, toll-free fax for orders 1-800-511-3654Custom DNA (right)


Version française ici

 

Primers, probe and positive control for the Omicron variant of SARS-CoV-2 (Covid-19 virus), developed by the Joint Research Centre (JRC) of the European Commission (https://ec.europa.eu/jrc/en/news/efficient-tracing-omicron-new-pcr-test) :

Name

Sequence (5’ to 3’); in green color : mutations specific to the Omicron

Size (number of bases)

Omt-F

AACAAACCTTGTAATGGTGTTGC

23

Omt-R

TGCTGGTGCATGTAGAAGTTC

21

Omt-P

FAM-GATCATATAGTTTCCGACCCACTTATGGTGTTGGTC-BHQ1

36

Amplicon (positive control)

AACAAACCTTGTAATGGTGTTGCAGGTTTTAATTGTTACTTTCCTTTACGATCATATAGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCA

138


 

Here is a new reverse primer for the RNase P gene as a replacement for the faulty CDC RNase P reverse primer causing false positives and "contamination" problems in Covid-19 testing:  

Faulty CDC RNase P reverse primer: GAGCGGCTGTCTCCACAAGT

New correct primer from Rob Dekker and co-authors at the University of Amsterdam in the Netherlands:

RNase P (UVA)-R: GATAGCAACAACTGAATAGCCAAGGT

We would like to strongly recommend to everyone replacing the faulty CDC primer with the above primer from the article of Rob Dekker et al. (link to the full-length article http://genseq-h0.science.uva.nl/download/Overhauling_a_faulty_CDC_SARS-CoV-2_rRT-PCR_control-UvA-vfin.pdf ).  The article also explains how and why exactly the CDC primer is faulty.  

NEW:  COVID-19 primers and probes used in different counties worldwide, according to the WHO (the World Health Organization)
Primer/probe name DNA sequence (5' to 3') recommended primer/probe final concentration (nM = nmol/liter) Alpha DNA (Alpha ADN) synthetic DNA primers and probes
catalog number synthesis scale guaranteed minimum DNA quantity (desalted oligonucleotides) Number of reactions per delivered product, 25 µl PCR reaction volume) Price in USD
Primers and probes allowed by the CDC (Atlanta, Georgia) for use in the USA:
2019-nCoV_Nl-F  GACCCCAAAATCAGCGAAAT 500 nM U1 200 nmol 50 nmol /10 OD >4000 7.80
2019-nCoV_Nl-R  TCTGGTTACTGCCAGTTGAATCTG 500 nM U2 200 nmol 50 nmol /10 OD >4000 9.36
2019-nCoV_Nl-P  FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 125 nM U3 200 nmol 50 nmol /10 OD >16000 88.36
2019-nCoV_N2-F  TTACAAACATTGGCCGCAAA 500 nM U4 200 nmol 50 nmol /10 OD >4000 7.80
2019-nCoV_N2-R  GCGCGACATTCCGAAGAA 500 nM U5 200 nmol 50 nmol /10 OD >4000 7.02
2019-nCoV_N2-P  FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1 125 nM U6 200 nmol 50 nmol /10 OD >16000 87.97
2019-nCoV_N3-F  GGGAGCCTTGAATACACCAAAA 500 nM U7 200 nmol 50 nmol /10 OD >4000 8.58
2019-nCoV_N3-R  TGTAGCACGATTGCAGCATTG 500 nM U8 200 nmol 50 nmol /10 OD >4000 8.19
2019-nCoV_N3-P  FAM-AYCACATTGGCACCCGCAATCCTG-BHQ1 125 nM U9 200 nmol 50 nmol /10 OD >16000 88.36
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG 500 nM U10 200 nmol 50 nmol /10 OD >4000 7.41
RP-R RNAse P Reverse

GAGCGGCTGTCTCCACAAGT (please avoid ordering

 this faulty CDC primer and replace it with the

 primer in the news alert above) RNase P

 (UVA)-R:

 GATAGCAACAACTGAATAGCCAAGGT

500 nM U11 200 nmol 50 nmol /10 OD >4000 7.80
RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1 125 nM U12 200 nmol 50 nmol /10 OD >16000 87.97
 
Primers and probes used in mainland China (新型冠状病毒核酸检测引物和探针序列) :
Target 1ORF1ab:              
正向引物 ORF1ab(F): CCCTGTGGGTTTTACACTTAA 500 nM C1 200 nmol 50 nmol /10 OD >4000 8.19
反向引物 ORF1ab(R): ACGATTGTGCATCAGCTGA 500 nM C2 200 nmol 50 nmol /10 OD >4000 7.41
荧光探针 ORF1ab(P): FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1 150 nM C3 200 nmol 50 nmol /10 OD >13333 89.92
Target 2N:              
正向引物 N(F): GGGGAACTTCTCCTGCTAGAAT 500 nM C4 200 nmol 50 nmol /10 OD >4000 8.58
反向引物 N(R): CAGACATTTTGCTCTCAAGCTG 500 nM C5 200 nmol 50 nmol /10 OD >4000 8.58
荧光探针 N(P): FAM-TTGCTGCTGCTTGACAGATT-BHQ1 150 nM C6 200 nmol 50 nmol /10 OD >13333 86.8
 
Primers and probes used in the Hong Kong Special Administrative Region of China:
Assay 1 (Target: ORF1b-nsp14)
HKU-ORF1b-nsp14F TGGGGYTTTACRGGTAACCT 500 nM H1 200 nmol 50 nmol /10 OD >4000 7.80
HKU- ORF1b-nsp14R AACRCGCTTAACAAAGCACTC 500 nM H2 200 nmol 50 nmol /10 OD >4000 8.19
(HKU-ORF1b-nsp141P FAM-TAGTTGTGATGCWATCATGACTAG-BHQ1 250 nM H3 200 nmol 50 nmol /10 OD >8000 88.36
Assay 2 (Target: N)              
HKU-NF TAATCAGACAAGGAACTGATTA 500 nM H4 200 nmol 50 nmol /10 OD >4000 8.58
HKU-NR CGAAGGTGTGACTTCCATG 500 nM H5 200 nmol 50 nmol /10 OD >4000 7.41
HKU-NP FAM-GCAAATTGTGCAATTTGCGG-BHQ1 250 nM H6 200 nmol 50 nmol /10 OD >8000 86.80
               
Primers and probes used in Japan:
1)      ORF1a set (regular PCR, not real-time PCR)
NIID_WH-1_F501 (S) TTCGGATGCTCGAACTGCACC 500 nM J1 200 nmol 50 nmol /10 OD >4000 8.19
NIID_WH-1_R913 (AS)  CTTTACCAGCACGTGCTAGAAGG 500 nM J2 200 nmol 50 nmol /10 OD >4000 8.97
NIID_WH-1_F509 (S)  CTCGAACTGCACCTCATGG 500 nM J3 200 nmol 50 nmol /10 OD >4000 7.41
NIID_WH-1_R854 (AS)  CAGAAGTTGTTATCGACATAGC 500 nM J4 200 nmol 50 nmol /10 OD >4000 8.58
NIID_WH-1_Seq_F519 (S)  ACCTCATGGTCATGTTATGG 500 nM J5 200 nmol 50 nmol /10 OD >4000 7.80
NIID_WH-1_Seq_R840 (AS)  GACATAGCGAGTGTATGCC 500 nM J6 200 nmol 50 nmol /10 OD >4000 7.41
2)      S set (regular PCR, not real-time PCR)
WuhanCoV-spk1-f (S)  TTGGCAAAATTCAAGACTCACTTT 500 nM J7 200 nmol 50 nmol /10 OD >4000 9.36
WuhanCoV-spk2-r (AS)  TGTGGTTCATAAAAATTCCTTTGTG 500 nM J8 200 nmol 50 nmol /10 OD >4000 9.75
NIID_WH-1_F24381 (S)  TCAAGACTCACTTTCTTCCAC 500 nM J9 200 nmol 50 nmol /10 OD >4000 8.19
NIID_WH-1_R24873 (AS)  ATTTGAAACAAAGACACCTTCAC 500 nM J10 200 nmol 50 nmol /10 OD >4000 8.97
NIID_WH-1_Seq_F24383 (S)  AAGACTCACTTTCTTCCACAG 500 nM J11 200 nmol 50 nmol /10 OD >4000 8.19
NIID_WH-1_Seq_R24865 (AS)  CAAAGACACCTTCACGAGG 500 nM J12 200 nmol 50 nmol /10 OD >4000 7.41
3)      Primers and probes for real-time RT-PCR
NIID_2019-nCOV_N_F2  AAATTTTGGGGACCAGGAAC 500 nM J13 200 nmol 50 nmol /10 OD >4000 7.80
NIID_2019-nCOV_N_R2  TGGCAGCTGTGTAGGTCAAC 700 nM J14 200 nmol 50 nmol /10 OD >2857 7.80
NIID_2019-nCOV_N_P2  FAM-ATGTCGCGCATTGGCATGGA-BHQ 200 nM J15 200 nmol 50 nmol /10 OD >10000 86.41
 
Primers and probes used in Germany:
Assay 1 (RdRRP)
RdRP_SARSr-F2  GTGARATGGTCATGTGTGGCGG 600 nM G1 200 nmol 50 nmol /10 OD >3333 8.58
RdRP_SARSr-R1  CARATGTTAAASACACTATTAGCATA 800 nM G2 200 nmol 50 nmol /10 OD >2500 10.14
RdRP_SARSr-P2  FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1 100 nM G3 200 nmol 50 nmol /10 OD >20000 88.75
(the above probe is specific for 2019-nCoV, will not detect SARS-CoV)
RdRP_SARSr-P1  FAM-CCAGGTGGWACRTCATCMGGTGATGC-BHQ1 100 nM G4 200 nmol 50 nmol /10 OD >20000 89.14
(the above probe is a Pan-Sarbeco probe, will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs)
Assay 2 (E gene) (this set is identical to the one used in France, as is the final concentration of the primers and probes)
E_Sarbeco_F1  ACAGGTACGTTAATAGTTAATAGCGT 400 nM G5 200 nmol 50 nmol /10 OD >5000 10.14
E_Sarbeco_R2  ATATTGCAGCAGTACGCACACA 400 nM G6 200 nmol 50 nmol /10 OD >5000 8.58
E_Sarbeco_P1  FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 200 nM G7 200 nmol 50 nmol /10 OD >10000 89.14
Assay 3 (N gene), see https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6988269/
N_Sarbeco_F CACATTGGCACCCGCAATC 600 nM G8 200 nmol 50 nmol /10 OD >3333 7.41
N_Sarbeco_R GAGGAACGAGAAGAGGCTTG 800 nM G9 200 nmol 50 nmol /10 OD >2500 7.80
N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BHQ1 200 nM G10 200 nmol 50 nmol /10 OD >10000 88.75
 
Primers and probes used in Thailand:
WH-NIC N-F  CGTTTGGTGGACCCTCAGAT 1000 nM T1 200 nmol 50 nmol /10 OD >2000 7.80
(the above primer partially overlaps with the CDC probe 2019-nCoV_Nl-P)            
WH-NIC N-R  CCCCACTGCGTTCTCCATT 1000 nM T2 200 nmol 50 nmol /10 OD >2000 7.41
WH-NIC N-P  FAM-CAACTGGCAGTAACCA-BQH1 250 nM T3 200 nmol 50 nmol /10 OD >8000 85.24
 
Primers and probes used in France (Insitut Pasteur, Paris):
RdRp gene / nCoV_IP2
nCoV_IP2-12669Fw  ATGAGCTTAGTCCTGTTG 400 nM F1 200 nmol 50 nmol /10 OD >5000 7.02
nCoV_IP2-12759Rv  CTCCCTTTGTTGTGTTGT 400nM F2 200 nmol 50 nmol /10 OD >5000 7.02
nCoV_IP2-12696bProbe HEX-AGATGTCTTGTGCTGCCGGTA-BHQ1 160 nM F3 200 nmol 50 nmol /10 OD >12500 87.19
RdRp gene / nCoV_IP4
nCoV_IP4-14059Fw  GGTAACTGGTATGATTTCG 400 nM F4 200 nmol 50 nmol /10 OD >5000 7.41
nCoV_IP4-14146Rv  CTGGTCAAGGTTAATATAGG 400 nM F5 200 nmol 50 nmol /10 OD >5000 7.80
nCoV_IP4-14084Probe(+)  FAM-TCATACAAACCACGCCAGG-BHQ1 160 nM F6 200 nmol 50 nmol /10 OD >12500 86.41
E gene/E_Sarbeco (this set is identical to the one used in Germany, as is the final concentration of the primers and probes)
E_Sarbeco_F1  ACAGGTACGTTAATAGTTAATAGCGT 400 nM F7 200 nmol 50 nmol /10 OD >5000 10.14
E_Sarbeco_R2  ATATTGCAGCAGTACGCACACA 400 nM F8 200 nmol 50 nmol /10 OD >5000 8.58
E_Sarbeco_P1  FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 200 nM F9 200 nmol 50 nmol /10 OD >10000 89.14

 

To Alpha DNA Home PageTo Alpha DNA address, fax and E-mail contact infoTo Alpha DNA Products and PricesTo Alpha DNA Useful Info


© 1997-2024  Alpha DNA